|
| |
 |
|
| ORIGINAL ARTICLE |
|
| Year : 2015 | Volume
: 2
| Issue : 2 | Page : 108-111 |
|
Prevalence of VKORC1 polymorphism in population of Hyderabad India
Amrita Rao1, Gita Sharma2, Livy Alex3, R Tapadia4
1 Research Associate, Tapadia Diagnostic Centre Pvt Ltd, Hyderabad, India
2 R&D Director, Tapadia Diagnostic Centre Pvt Ltd, Hyderabad, India
3 Director, Tapadia Diagnostic Centre Pvt Ltd, Hyderabad, India
4 Director Technical, SLS Cell Cure Technologies Pvt Ltd, Hyderabad, India
| Date of Web Publication | 5-Jul-2017 |
Correspondence Address:
Livy Alex
Director Technical, SLS Cell Cure Technologies Pvt Ltd, 103; Prabhat Apartments, Street No 11, East Marredpally, Secunderabad-500026
India
 Source of Support: None, Conflict of Interest: None
DOI: 10.5530/ami.2015.4.1
Introduction: Warfarin/Acitrom administration dosage varies based on patient genotype with respect to the gene: Vitamin K epoxide reductase complex 1 (VKORC1). Ethnic diversity contributes to genotype variation. The frequency of polymorphism at VKORC1 in population of Hyderabad has not been reported in literature; hence the present study was conducted. Material & Methods: Genomic DNA from peripheral blood leukocytes of patients on warfarin/acitrom as well as normal control population without any thrombotic disease was extracted and Restriction Fragment Length Polymorphism (RFLP) pattern was established for 1173C>T transition by standard protocols. Result: The incidence of homozygote dominants (CC) genotypes were 74.63% and that of heterozygotes (CT) were 25.37 %. No recessives were found in the study group. Conclusion: Presently genotype based dosage is not implemented. This study through its collaboration with practising cardiologist while establishing the test at our diagnostic centre has also enabled awareness and consequently if followed will improve patient safety.
Keywords: VKORC1, Polymorphism, Acitrom, Warfarin, Genotype, SNP
How to cite this article:
Rao A, Sharma G, Alex L, Tapadia R. Prevalence of VKORC1 polymorphism in population of Hyderabad India. Acta Med Int 2015;2:108-11 |
| Introduction | |  |
Thrombosis is a serious medical condition, but it can be treated effectively by anticoagulant therapy with drugs such as Warfarin. Warfarin interferes with synthesis of vitamin K-dependent clotting factors II, VII, IX, and X and anticoagulant proteins C and S. At a molecular level, Warfarin inhibits Vitamin K epoxide reductase (VKOR), specifically the VKORC1 subunit[1]. This inhibition results in accumulation of biologically inactive vitamin K and thus a reduction in vitamin K dependent clotting factor synthesis.
Based on United States of America Food and Drug Administration (US FDA) Adverse Event Reporting System (AERS), warfarin has been associated with 86% serious bleeding episodes and 10 % fatality during the period 1993-2005.Hence the dose of warfarin hence needs to be calibrated carefully as per their recommendation. If the dose is lower than optimal, the danger of thrombosis remains.[2],[3] If the dose is higher than optimal, then there is a risk of impaired clotting leading to hemorrhage.[2],[4],[5],[6] The optimal dose for Warfarin has been correlated to single nucleotide polymorphisms (SNPs) at the VKORC1 locus. Analysis of dose effectiveness has been reported to vary based on inter-individual and inter-ethnic comparisons that has revealed several significant SNPS which are at: Positions 1173 in intron 1 (genotypes CC, CT, or TT), and at position 3730 in the 3' untranslated region (genotypes GG, GA, or AA) as well as 1639G (genotypes AA, AG, or GG). These SNPs reflect on warfarin dose sensitivity/ resistance.[7],[8],[9],[10] For long-term therapy, certain VKORC1 variants require low dose of warfarin compared to wild type.[11],[12]
It has been well documented that the distribution of these polymorphisms are unique to different ethnic groups. Frequencies of polymorphism in different populations such as American, Chinese, Caucasian etc have been reported, however limited data is available on Indian population, one on Indian population from Taiwan and another of North Indian population, both on 1639 G>A transition[7],[13],[14],[15] have been reported.
The objective of the present study was to report the polymorphism of 1173 C>T site of VKORC1 gene in the population in Hyderabad and to investigate any possible correlation with optimal dose of Warfarin. Our study of 134 samples comprising of 63 control and 71 patient samples revealed that homozygous dominant genotype was predominant in the Hyderabad population and homozygous recessives were absent in the sample under study.
| Materials and Methods | | |
Materials
For genomic DNA isolation chemicals were purchased from different manufacturers like Fischer Scientific, Qualigens, Merck, Genei, Rankem, SRL etc.
The primers were synthesized and provided by Bioserve Biotechnologies Pvt Ltd, India. The primers were supplied in desalted form reconstituted as per the requirement using sterile water for injection.Hot Start Taq polymerase was provided at a conc of 5U/ul and supplied with Hot Start 10X buffer(Mg free) and 25 mM MgCl2 and dNTP provided at 10mM conc and reconstituted to 2.5 mM as per the requirement using sterile water for injection.
Restriction enzyme Hinf1 was synthesized by Fermentas and supplied by Bioserve Biotechnologies Pvt Ltd at a concentration of 10 U/ul and included 10X buffer R.
Description of Study Cohort
The study population comprised of 134 subjects. Of these, 63 were control individuals without thrombotic disorder and 71 were patients receiving warfarin/acitrom (variable doses). Clinical data pertaining to age, sex, gender, warfarin dosage, and Prothrombin Time/International Normalized Ratio (PT/ INR) values were obtained from patients admitted in Care Hospital, Banjara Hyderabad. The study was approved by Ethical Committee of Care Hospital. The genotyping study was carried out at Tapadia Diagnostic Centre Pvt Ltd Hyderabad 500020.
Genotyping at VKORC Locus; Mutation at Site 1173 C>T Transition.
Blood samples (5ml) were collected in EDTA tubes. Genomic DNA was extracted from peripheral leukocytes by phenol chloroform method.[16] The quality and quantity of DNA was evaluated on 0.8% agarose gel [Figure 1]a and by UV spectrophotometry (Eppendorf Biophotometer). DNA was stored at -20°C until further use. | Figure 1: Genotyping of VKORC1 1173. a) Agarose gel showing genomic DNA (lane 1) and molecular size marker of 1 kb (lane M). b) Agarose gel showing PCR product of size 361 bp (lane 2) and DNA Ladder molecular size marker of 50bp (lane M of b &c). c) Agarose gel showing Hinf1 digestion of PCR products. Lane 3 represents CT with 353bp and 310bp and Lane 4 represents CC with 353bp.
Click here to view |
Genotyping of VKORC1 (1173 C>T) was done by Polymerase Chain Reaction (PCR)-based RFLP method described by[17] using forward (5' TGACATGGAATCCTGACGTG 3') and reverse (5'GAGCTGACCAAGGGGGAT 3') primers. These primers amplify a 361 base pair (bp) region from intron 1 of VKORC1 gene.[7] Genomic DNA (1 ng) was added to a standard PCR reaction mixture and amplified by initial denaturation at 94°C for 10 min followed by 30 cycles of denaturation (94°C for 30 sec.), annealing (58°C for 30 sec.) and elongation (72°C for 1.5 min.), followed by a final extension step (72° C for 5 min.).The amplified products were resolved on 3% agarose gel for quality check and then digested with Hinf1 restriction enzyme at 37°C for 2-3 hours. The digested products were visualized on 3% high resolution agarose gel stained with ethidium bromide. The image analysis of RFLP pattern was carried out using Uvitec gel documentation system with the Fire Reader software to calculate the molecular weight of the restricted fragments. The molecular weight values were assigned using 50 base pair and 100 base pair ladders obtained from Fermentas.
The data was compiled; a frequency distribution of genotypes calculated as percentages, the mean and standard deviation of the acitrom/warfarin dose was calculated as per standard protocols.
| Results | | |
RFLP genotyping of PCR product of VKORC1 1173C>T
PCR of genomic DNA with primers spanning the site 1173C>T in VKORC1-gene yielded a product of 361 bp [Figure 1]b.The wild type gene has a Hinf1 site within this 361 bp region thus on digestion yields two fragments of 353 bp and 8 bps.On resolution of the digested product the 353 bp fragment is visualized on a 3 % high resolution agarose gel, however the 8 bp fragment is not seen [Figure 1]c. In the mutant gene, a C>T transition occurs, as a consequence of which an additional restriction recognition site for Hinf1 is created. This on digestion with Hinf 1 results in three fragments of sizes: 310 bp, 43 bp and 8 bp. The 310 bp fragment can be observed on the gel while the other two are not. In our data we have observed samples having only one band corresponding to 353 bp which are scored as homozygous dominant CC genotype.Some samples had two bands one corresponding to 353 bp and another to 310 bp which are heterozygous for the loci CT genotype. [Figure 1]c. The third category which is homozygous recessive having only a band a of size 310 bp was not recorded in this study. Thus the incidence of this genotype is so low that in a total sample size of 134 even a single homozygous recessive was not encountered,
The genotype at the VKORC1 1173C>T was determined from the sizes of the bands. The gel image was viewed using UVITEC gel doc system with the help of Fire Reader software.
Genotype Frequencies of VKORC1 in Hyderabad Population
The patient recruitment in the study was random. No specific effort was made to enrol gender specific patients. [Table 1].
In the study, the frequency of CC genotype is 74.63%, CT genotype is 25.37 %. The homozygous dominant genotype is more abundant in the population under study [Table 1].
Genotype Frequencies of VKORC1 in Other Populations
Reports of frequencies of VKORC1 1173C>T polymorphism have been studied in African American, Caucasian and Norway populations too and the details of the same is described in [Table 2].
Acitrom dose Variation According to Genotype
The mean daily acitrom dose was 2.42 mg in patients with CC genotype. The homozygote dominants being extensive metabolizers required a higher dose regime to have the same stable effect due to medication. This was higher than the daily dose of patients with CT genotype (1.91 mg).The heterozygote's were intermediate metabolizers having a comparatively slow serum clearance and hence required lower dose for the same therapeutic effect [Figure 2]. | Figure 2: Mean dosage of acitrom for different genotypes in the population under study The mean acitrom dose is 2.42mg and for CC genotype and 1.91mg for CT genotype.
Click here to view |
| Discussion | | |
Genetic prediction of antithrombotic medication response has the potential to reduce trial and error regime by the clinician and its associated risk of therapy and resources needed to treat thrombotic patients. VKORC1 genotyping has the potential to facilitate the development of individually tailored warfarin dosing strategies to reduce the risk of over –anticoagulation or bleeding episodes. However apart from these SNPs, other intrinsic and extrinsic factors play a role in accurate dosage prediction.The response pattern is measured in terms of PT, INR values of the patient.This in turn is a function of interplay of all the genes involved in the clotting pathway as well as the various cytochrome P450 involved in the breakdown of acitrom/warfarin which are: CYP2C9 for S.warfarin & CYP1A1, CYP1A2 and CYP3A4 for R- warfarin.
The present study performed genotyping of VKORC1 gene on 134 individuals in Hyderabad population. The homozygote dominant (CC) genotype was frequent in the population under study as compared to heterozygote (CT). Individuals with CC genotype can withstand a higher dose of warfarin than CT or TT genotype individuals.
Many factors need to be taken into account for assessing acitrom/warfarin dosing like age, sex, height, weight, INR monitoring during both initiation and maintenance phases of therapy which was lacking in the study due to inability to obtain all relevant data due to unavoidable circumstances.
The genotype frequency of different populations was compared. It was observed that the genotype distribution of Norway and Caucasian population were quite similar and that of African American and Hyderabad populations were more related where recessive genotype were almost negligible in both these.
| Conclusion | | |
We have reported the distribution of VKORC1 polymorphism in the local population, Hyderabad, AP, India. It is observed that the population of Hyderabad has predominantly homozygote dominant: CC genotype and the heterozygotes CT genotype were 25.37 %.Recessive genotypes were not recorded in this study. It is established in literature that the frequency of homozygous recessives is very low.VKORC1 gene encodes for the subunit of Vitamin K epoxide reductase complex. This plays a significant role in the modulation of the anticoagulant effect of the prescribed warfarin dose. Genotyping patients prior to, or shortly after, starting Warfarin could improve achievement of a stable INR and potentially reduce the rate of early bleeding. The relation between gene polymorphisms and bleeding frequency during warfarin treatment needs to be further investigated in larger studies with sufficient statistical analysis.
| Acknowledgements | | |
We wish to acknowledge Dr. Srinivas Kumar, Dr.Shanthi Naidu and management of Care Hospital, Banjara for giving the ethical committee acceptance. We appreciate all the help of Dr Srinivas for his inputs from the medical perspective. We are further grateful to R.Tapadia in offering guidance from a clinical standpoint and also the unflinching financial support during this study.We are thankful to BCIL for providing the fellowship to Ms Amrita Rao.
| Abbreviations | | |
Vitamin K Epoxide Reductase Complex 1 (VKORC1), Restriction Fragment Length Polymorphism (RFLP), United States of America Food and Drug Administration(USFDA), Adverse Event Reporting System(AERS), Single Nucleotide Polymorphism (SNP), Prothrombin Time/International Normalized Ratio(PT/INR), Polymerase Chain Reaction(PCR), base pair(bp).
| References | | |
| 1. | Whitlon DS, Sadowski JA, Suttie JW. Mechanism of coumarin action. Significance of Vitamin K epoxide reductase inhibition. Biochemistry 1978; 17: 1371–1377.  |
| 2. | Fihn SD, McDonell M, Martin D, Henikoff J, Vermes D, Kent D et al. Risk factors for complications of chronic anticoagulation. Ann Intern Med 1993; 118: 511–520 |
| 3. | Stroke Prevention in Atrial Fibrillation Investigators Adjusted-dose warfarin versus low-intensity, fixed dose warfarin plus aspirin for high risk patients with atrial fibrillation: Stroke Prevention in Atrial Fibrillation III randomised clinical trial. Lancet 1996; 348: 633–638. |
| 4. | Anticoagulants in the Secondary Prevention of Events in Coronary Thrombosis (ASPECT) Research Group Effect of long-term oral anticoagulant treatment on mortality and cardiovascular morbidity after myocardial infarction. Lancet 1994;343: 499–503. |
| 5. | Cannegieter SC, Rosendaal FR, Wintzen AR, van der Meer FJ, Vandenbroucke JP, et al. Optimal oral anticoagulant therapy in patients with mechanical heart valves. N Engl J Med.1995; 333: 11–17. |
| 6. | Stroke Prevention in Atrial Fibrillation Investigators. Bleeding during antithrombotic therapy in patients with atrial fibrillation. Arch Intern Med. 1996; 156: 409–416. |
| 7. | D'Andrea, G, R.L.D'Ambrosia, P.DiPerna, M.Chetta and R.Santacroce et al. A polymorphism in the VKORC1 gene is associated with an interindividual variability in the dose-anticoagulant effect of warfarin. Blood. 2005;105: 645–649. |
| 8. | Geisen,C,M.Watzka,K.Sittinger,M.Steffens,L.Daugela. VKORC1 haplotypes and their impact on the inter-individual and inter- ethnical variability of oral anticoagulation.Thromb.Haemost. 2005; 94: 773–779. |
| 9. | Lee, SC., SS Ng, J.Oldenburg, P.Y Chong, S.Rose. Interethnic variability of warfarin maintenance requirement is explained by VKORC1 genotype in an Asian population.Clin Pharmacol.Ther. 2006; 79: 197–205. |
| 10. | Yuan H.Y,JJ.Chen,MT Lee,J.C Wung,Y.F Chen et al. A novel functional VKORC1 promoter polymorphism is associated with inter-individual and inter-ethnic differences in warfarin sensitivity. Hum Mol Genetics. 200;14: 1745–1751. |
| 11. | Schwarz UI,Ritchie MD, Bradford Y, Li C, Dudek SM, Frye- Anderson A, Kim RB et al. Genetic determinants of response to warfarin during initial anticoagulation.N Engl J Med. 2008; 358: 999–1008. |
| 12. | Limdi,NA,DK.Amett,JA.Goldstein,T.M. Beasley, M.J Reider Influence of CYP2C9 and VKORC1 polymorphisms on warfarin dose, anticoagulation attainment and maintenance among European American and African Americans.Pharmacogenomics. 2008;9: 511–526. |
| 13. | Kari Bente Foss Haug, Mohammad N Sharikabad, Marianne K Kringen, Sigrid Narum, Stine T Sjaatil et al. Warfarin dose and INR related to genotypes of CYP2C9 and VKORC1 in patients with myocardial infarction. Thrombosis Journal 2008, 6:7 doi:10.1186/1477-9560-6–7 |
| 14. | H Schelleman, Z chen, C kealey, AS Whitefield, J Christie, et al. Warfarin Response and Vitamin K Epoxide Reductase Complex 1 in Africans Americans and Caucasians.Clinical Pharmacology & Therapeutics.2007; 81: 5 742–747. |
| 15. | Saurabh S Rathore,Surendra K Agarwal,Shantanu Pande,Tulika Mittal,Balraj Mittal. Frequencies of VKORC1 -1639G>A,CYP2C9*2 and CYP2C9*3 genetic variants in the Northern Indian population. Bioscience Trends.2010; 4:6 333–337. |
| 16. | Dacie and Lewis(2007) Practical Haematology. Churchill Livingstone, (10 th edn), pp 580–582. |
| 17. | Z Kianmehr, P.Ghadam, S Sadrai,B Kazemi, R.A Sharifian. VKORC1 Gene Analysis of Some Iranian Sensitive Patients to Warfarin.Pak J Bio Sc. 2010;13: 18906–18910. |
[Figure 1], [Figure 2]
[Table 1], [Table 2]
|
Search Pubmed for