• Users Online: 34
  • Print this page
  • Email this page


 
 
Table of Contents
ORIGINAL ARTICLE
Year : 2015  |  Volume : 2  |  Issue : 2  |  Page : 51-53

HOXA9 gene expression and cytogenetic analysis in Egyptian acute myeloid leukemia patients


1 Department of Hematology, Faculty of Medicine, Faculty of Science, Alexandria University, Egypt
2 Department of Biochemistry, Faculty of Medicine, Faculty of Science, Alexandria University, Egypt
3 Department of Medical Biochemistry, Faculty of Medicine, Faculty of Science, Alexandria University, Egypt

Date of Web Publication5-Jul-2017

Correspondence Address:
Nahla A. M Hamed
Professor of Haematology, Internal Medicine Department, Faculty of Medicine, Alexandria University
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.5530/ami.2015.3.1

Rights and Permissions
  Abstract 


Aim: we investigatedthe frequency of expression of HOXA9 gene in adult Egyptian acute myeloid leukemia (AML) patients and its relation to different cytogenetic abnormalities. Methods: 30 newly diagnosed AML patients (group 1) were the subject of our study. Ten healthy persons of matched age and sex were considered group ll (controls). Estimation of HOXA9 expression in AML blasts by RT-PCR was done to both groups. Results: Normal cytogenetic analysis was present in 20 cases (66.6%), t(15,17) in 3 cases, t(8,21) in 3 cases, 45 xy -7 in 1 case, t(16,16) in 1 case, 45 xy-20 in 1 case and 46 XX 1P+ in 1 case. NUP 98 -HOXA 9 gene was not detected in any of the studied case or in the control group. Conclusion: absence of HOXA9 gene in our randomly selected patientsmay be related to its rarity in Egyptian population. However, further studies including larger population is still needed to confirm this finding with special stress on poor cytogenetic group

Keywords: HOXA9, Cytogenetics, Acute leukemia


How to cite this article:
Neanaa H, Hamed NA, Raafat A, Diab I, Rahman AA. HOXA9 gene expression and cytogenetic analysis in Egyptian acute myeloid leukemia patients. Acta Med Int 2015;2:51-3

How to cite this URL:
Neanaa H, Hamed NA, Raafat A, Diab I, Rahman AA. HOXA9 gene expression and cytogenetic analysis in Egyptian acute myeloid leukemia patients. Acta Med Int [serial online] 2015 [cited 2019 Jul 16];2:51-3. Available from: http://www.actamedicainternational.com/text.asp?2015/2/2/51/209652




  Introduction Top


Acute myeloid leukemia (AML) is a genetically heterogeneous disorder characterized by the somatic acquisition of genetic and epigenetic alterations in hematopoietic progenitor cells that disturb normal mechanisms of self-renewal, proliferation and differentiation. In recent years, there has been increasing translation of genetic diagnostics into the clinical setting.[1]

In the current World Health Organization classification, more than half of AML cases are categorized on the basis of their underlying genetic defect. Furthermore, cytogenetic and molecular genetic changes have been shown to be among the most powerful prognostic markers. Finally, novel therapies are being developed that target some of these genetic and epigenetic changes.[1]

In humans, there are 39 Class I homeobox (HOX) genes found in four genomic clusters (HOXA, HOXB, HOXC, and HOXD). Their expression is critical for body patterning during development, and for post-developmental regulatory functions. Aberrant HOX gene expression initiates leukemias.[2],[3] HOXA9 particularly is important in leukemia by suppressing differentiation and maintaining self-renewal during myelopoiesis.[4] HOXA9 expression is predominant in myeloid neoplasias.[5] In addition, HOXA9has been identified as the most reliable predictor of disease outcome.[3],[5]

Aim of the Work

We aimed at investigating the frequency of expression of HOXA9 gene, and its relation to different cytogenetic abnormalities in adult Egyptian AML patients.


  Methods Top


Patients

This study was performed on 30 newly diagnosed AML patients randomly selected from the Hematology Unit at Alexandria Main University hospital in Egypt.Their age ranged from 18-56 years. 17 patients were males and 13 were females. Based on cytogenetic analysis,[6] patients were categorized into: favorable group (7 patients), intermediate group (22 patients) and unfavorable group (1 patient). The study also included 10 healthy persons of matched age and sex and they were considered group ll (controls).

All patients in this study were subjected to: thorough history taking and detailed clinical examination, routine investigations including complete blood picture, bone marrow aspiration, immune-phenotyping, cytochemical staining (myeloperoxidase and Sudan black B), cytogenetic analysis byG-banding[7] and estimation of HOXA9 expression in AML blasts by RT-PCR.[8]

Estimation of HOXA9 expression in AML blasts by RT-PCR

Total RNA was extracted from whole blood EDTA samples using the E.Z.N.A RNA extraction Kit(Omega, bio-tek) (according to manufacturer's instructions).

For RT-PCR: The master mix RT-PCR beads kit which combines cDNA synthesis from RNA with PCR amplification was used. The following primer set was used: Forward primer: TGTGGTTCTCCTCCAGTTGATAGA

Reverse primer: TCGGTGAGGTTGAGCAGTCGAG, which amplifies a fragment of 267 bp for human HOXA9.[9]

The total reaction volume was 50 μL, containing 10 μL of RNA, 0.4 mM of each primer (forward and reverse primer) were added for each tube containing the PCR master mix beads. The thermal cycler conditions included a step for reverse transcription (42 °C for 15-30 minutes). Then an initial PCR activation step (15 min, 95 °C); 35 cycles consisting of denaturation (1 min, 95 °C), annealing (1 min, 55 °C), and extension (2 min, 72 °C); and a final extension step (10 min, 72 °C).


  Results Top


Cytogenetic analysis: Normal cytogenetic was present in 20/30 cases (66.6%). t(15,17) was present in 3 cases, t(8,21) in 3 cases, 45 xy -7 in 1 case, t(16,16) in 1 case, 45 xy-20 in 1 case and 46 XX 1P+ in 1 case.

NUP 98 -HOXA 9 genein AML blasts by RT-PCR: was not detected in all AML patients or in the control group, [Figure 1].
Figure 1: Gel electrophoresis of RT-PCR showing expression of housekeeping gene (lane 5) and absence of NUP98- HOXA 9 gene (lanes 1, 2, 3, 6 and 7)

Click here to view


Relation between response to chemotherapy and cytogenetic pattern: 22/30 patients were categorized as intermediate risk category.20/22 patients (90.9%) of them had normal cytogenetic.Among those with normal cytogenetic, 11/20 patients(55%) had achieved completeremission, 4 patients attained partial remission while 3 patients were refractory to chemotherapy [Table 1]. 2 patients died before receiving chemotherapy.
Table 1: Relation between response to chemotherapy and cytogenetic pattern

Click here to view



  Discussion Top


There is difference in the apparent oncogenecity of HOXA genes in myeloid and lymphoid compartments.It had been suggested that the transcriptional effects of HOX genes are strongly modulated by the spectrum of DNA-binding partnerspresent in a particular lineage. Perhaps, lineage specific patterns of chromatin structure, could also affect the accessibility of HOX proteins to some genomic regions.[9],[10]

HOXA9gene was expressed significantly more frequently in myeloid cell lines than in lymphoid cell lines[11]. That is why we selected to study acute myeloid leukaemia rather than acute lymphoblastic leukaemia. NUP 98- HOXA 9 gene was not detected in any of our studied patients orcontrol group.A previous study examined the expression of the HOXA cluster genes (HOXA9, HOXA10, and HOXA11) in leukemic cell lines by RT-PCR.[11] The HOXA9, HOXA10, and HOXA11genes were expressed in 12 of 16 (75.0%), 14 of 16 (87.5%) and 14 of 16 (87.5%) myeloid lineage cell lines.[11]

The absence of NUP 98-HOXA 9 gene expression in all our patients maybe attributed to the absence of translocation t(7;11)(p15;p15) in our studied cases. There aresome morphological features associated with t(7;11)(p15;p15), including predominantly the AML-M2 subtype with trilineage myelodysplastic features.[12],[13]

AML-M2 was present in seven cases (23.33%) in our study. No dysplastic feature was detected in any case. Inthe translocation t (7;11), the NUP98gene (11p15.4), is fused to the class-1 homeobox gene HOXA9 (7p15)[14]. The NUP98gene (11p15.4) codes for a component of the nuclear pore complex that regulates nucleo-cytoplasmic transport of RNA and proteins.[14]

At least two mechanisms for Nup98-HOXA9 leukemogenesis can be proposed; 1) interference with nuclear transport, e.g. preventing nuclear import of transcription factors critical for myeloid differentiation, or interference with the export of RNAs needed for myeloid differentiation, 2) aberrant transcription. Nup98-HOXA9 may cause leukemia by interfering with the transcriptional programs of hematopoietic differentiation and proliferation[13]. Splicing in Hox gene is also assigned to play a central task in Hox gene mediated leukaemogenesis.[15]

As regards cytogenetics, 20 cases in our study had normal cytogenetics (66.6%), and 10 cases had cytogenetic abnormalities (33.3%). The numerical abnormalities were present in 10 % of cases (monosomy 7, one case, monosomy 20,one case, and 1p+, one case). The most common structural chromosomal abnormalities were t(8;21) in 3 cases (10%), t(15;17) in 3 cases (10%), followed by t(16;16) in 1 case (3.3%).This means that 29/30 cases were either good or intermediate riskcytogeneticswhile only one case lies in poor risk cytogenetic (-7).

Lower HOXA9 expression was the best predictor of overall/ disease-free survival and response to therapy.[16] However this appears to reflect certain category of patients in certain population.


  Conclusion Top


From the previous study, we can conclude thatHOXA9 was absent in our randomly selected patients.This may be related to geographical distribution. Further study was recommended on wider scale of patients with special stress on bad prognostic category and in those harboring t(7;11)- associated leukemias.



 
  References Top

1.
Hartmut D, Verena IG. Impact of genetic features on treatment decisions in AML.Hematology2011;1:36–42.  Back to cited text no. 1
    
2.
Borrow J, Shearman AM, Stanton VP, Jr., et al. The t(7;11)(p15;p15) translocation in acute myeloid leukemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9. Nat Genet 1996;12: 159–67.  Back to cited text no. 2
    
3.
Golub TR, Slonim DK, Tamayo P, et al. Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science 1999;286:531–7.  Back to cited text no. 3
    
4.
Bruno MC, Justin SS, Ying CJC, Heidi SP, Kenneth DA, Giuseppe Z, Janice NC, David J, Jane F, Rui MR, Joseph FC. Reversing HOXA9 oncogene activation by PI3K inhibition: epigenetic mechanism and prognostic significance in human glioblastoma. Cancer Res2010; 70(2); 453–62.  Back to cited text no. 4
    
5.
Christian B, Sebastian B, Dorothe'e M, María-Paz Gl, Emanuel M, Robert KS. Leukemogenic transformation by HOXAclusters genes. Blood2010; 115: 2910–8.  Back to cited text no. 5
    
6.
Frohling S, Scholl C, Gilliland DG. Genetics of myeloid malignancies—pathogenetic and clinical implications. J ClinOncol 2005;23:6285–95.  Back to cited text no. 6
    
7.
Stasi R, Del Poeta G, Masi M, et al. Incidence of chromosome abnormalities in de-novo acute myeloid leukemia. Cancer Gent Cytogenet 1993; 67: 28–34.  Back to cited text no. 7
    
8.
Mallet F, Oriol G, Mary C, Mandraud B. Continuous RT-PCR using AMV-RT, Tag DNA polymerase: characterization and comparison to uncoupled procedures. Bio Techniques 1995; 18: 678–87.  Back to cited text no. 8
    
9.
Lawrence HJ, Fischbach, NA, Largman C. HOX genes: not just myeloid oncogenes any more. Leukemia 2005: 19, 1328–30.  Back to cited text no. 9
    
10.
Li Z, Zhang Z, Li Y, Arnovitz S, Chen P, Huang H, Jiang X, Hong GM, Kunjamma RB, Ren H, He C, Wang CZ, Elkahloum AG, Valk PJ. Dohner K, Neilly MB, Bullinger L, Delwel R, Lowenberg B, Liu PP, Morgan R, Rowley JD, Yuan CS, Chen J. PBX3 is an important cofactor of HOXA9 in leukemogenesis. Blood 2013; 121 (8): 1422–31.  Back to cited text no. 10
    
11.
Takeshi T, Tomohiko T, Ryoichi O, Yukio K, Kohmei I, Yasuhide H. The chromosome translocation t(7;11)(p15;p15) in acute myeloid leukemia results in fusion of the NUP98 gene with a HOXA cluster gene, HOXA13, but not HOXA9. Genes, chromosomes & cancer 2002; 34:437–43.  Back to cited text no. 11
    
12.
Kwong YL, Chan TK. Translocation (7;11)(p15;p15) in acute myeloid leukemia M2: association with trilineagemyelodysplasia and giant dysplastic myeloid cells. Am J Hematol 1994;47:62–4.  Back to cited text no. 12
    
13.
Nakamura T, Largaespada DA, Lee MP, et al. Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukemia. Nat Genet 1996;12:154–8.  Back to cited text no. 13
    
14.
Maconochie M, Nonchev S, Morrison A, et al. ParalogousHox genes: function and regulation. Annu Rev Genet 1996;30:529–56.  Back to cited text no. 14
    
15.
Stadier CR, VegiN,Mulaw MMA, Edmaier KE, Rawat VP, Dolnik A, Bullinger L, Heilmeier B, Quintanilla-Fend L, Speikermann K, Hiddemann W, Dohner K, Dohner H, Feuring-Buske M, Buske C. the leukemogenicity of HOXA9 depends on alternative splicing. Leukemia 2014; 28(9): 1838–43.  Back to cited text no. 15
    
16.
Andreeff M, Ruvolo V, Gadgil S, et al. HOX expression patterns identify a common signature for favorable AML. Leukemia 2008; 22: 2041–2047.  Back to cited text no. 16
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed515    
    Printed21    
    Emailed0    
    PDF Downloaded44    
    Comments [Add]    

Recommend this journal